Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

151 – 165 of 1,191 results

151

MilliporeSigma™ Upstate™ Acetyl-Histone H3, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	P68431
Includes	Acetyl-Histone H3 ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3Ac.
Antigen	Acetyl-Histone H3
Regulatory Status	RUO
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (rabbit polyclonal IgG). One vial containing 125μg of protein A purified antibody in 125μL of storage buffer containing 0.1M Tris-glycine, pH 7.4, 0.15M NaCl, 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg of normal rabbit IgG in 125μL volume. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The acetyl-histone H3 antibody is made against a peptide corresponding to amino acids 1-20 of Tetrahymena histone H3 ARTKQTAR[K]STGG[K]APRKQL(C) where [K] is acetylated)
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes acetyl-histone H3

152

BD PE Mouse NK Cell Separation Set - DM

For positive selection or depletion of NK and NK-T cells using BD IMagnet™

Pricing & Availability

153

MilliporeSigma™ RIPAb+™ HuR RIP Validated Antibody and Primer Set

This RIPAb+ HuR -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

154

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

155

R&D Systems™ TLR Screening Antibody Pack

A Novus product, part of R&D Systems. For Research applications

Pricing & Availability
Specifications

Antigen	TLR Screening
Content And Storage	Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Gene Alias	Toll like receptor, Toll-like receptor, Toll-like receptor (TLR)
Conjugate	Unconjugated
Target Species	Human,Mouse
Applications	Flow Cytometry,Immunocytochemistry,Immunohistochemistry,Immunohistochemistry (Paraffin),Immunoprecipitation,Western Blot
Immunogen	Following are the different antibodies included in the TLR Sampler Kit: TLR1:25 ug:WB, Flow:H, M, R:Purified TLR2 :25 ug:WB, IHC:H, M:Purified TLR2:25 ug:Flow, IP, ICC:H, D:Purified TLR3:25 ug:WB, Flow, IP, IHC:H:Purified TLR4:25 ug:Flow, IP, CM, FA-Neut:H:Purified TLR5:25 ug:WB, Flow, IHC:H, M, R:Purified TLR7:25 ug:WB, Flow, IHC, IP, IF/ICC:H, M:Purified TLR8:25 ug:WB, Flow, IHC:H, M:Purified TLR9:25 ug:WB, Flow, IHC, IF/ICC, CM:H, M, R, RM:Purified WB:Western Blot IHC:Immunohistochemistry IP:Immunoprecipitation CM:Confocal Microscopy FA-Neut Functional Assay Neutralization IF/ICC:Immunofluorescence/Immunocytochemistry D:Dog H:Human M:Mouse Mk:Monkey R:Rat RM:Rhesus Monkey

156

MilliporeSigma™ RIPAb+™ EF1α RIP Validated Antibody and Primer Set

This RIPAb+ EF1α -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

157

MilliporeSigma™ Upstate™ Dimethyl-Histone H3 (Lys4)α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for up to 12 months; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	Multiplex,ChIP sequencing (ChIP-seq),Dot Blot,Immunoassay,Western Blot
Form	Purified
Gene Accession No.	Q66I33
Isotype	IgG2b κ
Includes	This ChIPAb+ Dimethyl-Histone H3 (Lys4) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Dimethyl-Histone H3 (Lys4)α
Regulatory Status	RUO
Gene ID (Entrez)	NM_003493
Formulation	Anti-dimethyl-Histone H3 (Lys4) (mouse monoclonal IgG1, clone CMA303). One vial containing 50μg of protein G purified antibody in 50μL PBS containing 0.05% sodium azide. Normal Mouse IgG. Two vials containing 25μg purified Mouse IgG in 25μL storage buffer containing 0.1% sodium azide. ChIP Primers GAPDH Coding. One vial containing 75μL of 5μM of each primer specific for the coding region human GAPDH. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG
Immunogen	The dimethyl-histone H3 (Lys4) purified antibody is made against a synthetic peptide (dimethylated at Lys4) corresponding to amino acids 1-12 of histone H3.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes histone H3, Mr 17kDa, dimethylated at lysine 4.

158

MilliporeSigma™ Upstate™ Sox-2, clone 6F1.2α, 6F1.2, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Immunocytochemistry,Western Blot
Form	Purified
Gene Accession No.	P48431
Isotype	IgG2b κ
Includes	This ChIPAb+ Sox-2, clone 6F1.2 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Sox-2, clone 6F1.2α
Regulatory Status	RUO
Gene Symbols	SOX2; ANOP3; MGC2413; MCOPS3
Gene ID (Entrez)	NP_003097
Formulation	Anti-Sox-2, clone 6F1.2 (mouse monoclonal IgG). One vial containing 100μg of protein A purified antibody in 140μL of 0.02M phosphate buffer pH 7.6 with 0.25M NaCl containing 0.1% sodium azide, and 30% glycerol. ChIP Primers, nanog promoter. One vial containing 75μL of 5μM of each primer specific for the promoter region of human nanog. FOR: GTT CTG TTG CTC GGT TTT CT; REV: TCC CGT CTA CCA GTC TCA CC
Immunogen	Recombinant GST Fusion protein.
Classification	Monoclonal
Primary or Secondary	Primary
Clone	6F1.2
Test Specificity	Recognizes Sox-2, MW: ∽34kDa.

159

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys9) Serum, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Serum
Gene Accession No.	Q66I33
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys9) Serum -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys9) Serum
Regulatory Status	RUO
Gene Symbols	H3F3A, H3F3B, H3F3
Gene ID (Entrez)	NM_003493
Formulation	Anti-Acetyl-Histone H3 (Lys9) (rabbit polyclonal serum). One vial containing 25μL of antiserum containing 0.05% sodium azide before the addition of glycerol to 30%. Normal Rabbit Serum. One vial containing 25μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The acetyl-histone H3 (Lys9) antiserum is made against a peptide corresponding to amino acids 4-14 of yeast histone H3 acetylated on lysine 9.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Acetyl-Histone H3 (Lys9)

160

MilliporeSigma™ Upstate™ SMRTα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Electromobility Shift Assay,Immunocytochemistry,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Ascites
Gene Accession No.	Q9Y618
Isotype	IgG2a κ
Includes	The ChIPAb+ SMRT set includes the SMRT antibody, a negative control mouse ascites and qPCR primers which amplify a 299bp region of human IκBα promoter.
Antigen	SMRTα
Regulatory Status	RUO
Gene Symbols	NCOR2, CTG26, N-CoR2, SMAP270, SMRT, SMRTE, SMRTE-tau, TNRC14, TRAC, TRAC-1, TRAC1
Purification Method	Unpurified
Gene ID (Entrez)	NP_001070729.1
Formulation	Anti-SMRT (mouse monoclonal). One vial containing 50μL of unpurified mouse monoclonal ascites with 0.05% sodium azide. Negative Ascites (mouse). One vial containing 50μL of mouse ascites with 0.05% sodium azide. ChIP Primers, IκBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Recombinant protein corresponding to human SMRT.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SMRT.

161

MilliporeSigma™ Upstate™ JMJD6, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q6NYC1
Includes	This ChIPAb+ JMJD6 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	JMJD6
Regulatory Status	RUO
Gene Symbols	JMJD6, PTDSR1, PTDSR, PSR
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_001074930
Formulation	Anti-JMJD6 (rabbit polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl and 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of each primer (5μM) specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	Linear peptide corresponding to human JMJD6.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes JMJD6.

162

Mouse IL-4 ELISPOT Pair, BD

Convenient set of unlabelled anti-IL-4 capture antibody and a biotinylated anti-IL-4 detection antibody

Pricing & Availability

163

MilliporeSigma™ Upstate™ Histone H3.3, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Western Blot
Gene Accession No.	P84243
Includes	This ChIPAb+ Histone H3.3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Histone H3.3
Regulatory Status	RUO
Gene Symbols	H3F3A, H3.3A, H3F3, PP781, H3F3B, H3.3B
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_002098
Formulation	Anti-Histone H3.3 (rabbit polyclonal). One vial containing 50μg of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl with 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. Control Primers, GAPDH Coding Region D2 Human. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GCC ATG TAG ACC CCT TGA AGA G; REV: ACT GGT TGA GCA CAG GGT ACT TTA T
Immunogen	KLH-conjugated linear peptide corresponding to human Histone H3.3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes human Histone H3.

164

MilliporeSigma™ Upstate™ Phospho-CREB (Ser133), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Electromobility Shift Assay,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Purified
Gene Accession No.	P16220
Isotype	IgG
Includes	This ChIPAb+ Phospho-CREB (Ser133) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Phospho-CREB (Ser133)
Regulatory Status	RUO
Gene Symbols	CREB1, CREB, MGC9284
Purification Method	Purified by protein A-Sepharose followed by immunoadsorbant chromatography using an unphosphorylated CREB affinity gel column
Gene ID (Entrez)	NM_134442
Formulation	Anti-phospho-CREB (Ser133) (rabbit polyclonal). One vial containing 100μg of affinity purified rabbit serum in 0.1M Tris-Glycine (pH 7.4) 0.15M NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers cFos CRE. One vial containing 75μL of 5μM of each primer specific for the cFos CRE. FOR: GGC CCA CGA GAC CTC TGA GAC A; REV: GCC TTG GCG CGT GTC CTA ATC T
Immunogen	KLH-conjugated synthetic peptide corresponding to the amino acids including and encompassing phosphorylated Ser133 of CREB.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes p43 phosphorylated CREB. May also recognize p30 and p38kDa proteins. The p30 & p38 proteins may be phosphorylated CREM and ATF-1 respectively, since the two proteins share significant homology to the phosphorylated CREB immunizing peptide.

165

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

Antibody Panels and Kits

Filtered Search Results

Narrow Results